콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

추가 자료

EHU015351

Sigma-Aldrich

MISSION® esiRNA

targeting human AIM2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CGGTGTCTGCAGTGATGAAGACCATTCGTATTTTTCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGATAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTTTCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGACCCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTTTGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAATAGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTG

Ensembl | 인체 수납 번호

ENSG00000163568

NCBI 수납 번호

NM_004833

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AIM2(9447) , AIM2(9447)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

N Yoon et al.
Cell death & disease, 7, e2191-e2191 (2016-04-15)
Our recent study showed that human mesenchymal stem/stromal cells (hMSCs) are activated to express tumor necrosis factor (TNF)-α-related apoptosis-inducing ligand (TRAIL) by exposure to TNF-α and these activated hMSCs effectively induce apoptosis in triple-negative breast cancer MDA-MB-231 (MDA) cells in
Minda Zhang et al.
Journal of cellular physiology, 234(11), 20161-20173 (2019-04-07)
The human absent in melanoma 2 (AIM2) is considered as a DNA recognizer. AIM2 has been described as a tumor suppressor gene in the early years. But recent studies suggested that it functions as an oncogene in several cancers. However
Yunjia Yang et al.
Journal of cellular biochemistry, 120(10), 17744-17756 (2019-06-19)
Absent in melanoma 2 (AIM2) is a critical component in natural immunity system and is closely related to cancer initiation and development. It has been shown that AIM2 inhibited colorectal cancer (CRC) development and cell proliferation. It remains unresolved how
Ying Xu et al.
Oncotarget, 8(49), 86339-86355 (2017-11-22)
Hepatic ischemia/reperfusion (I/R) contributes to major complications in clinical practice affecting perioperative morbidity and mortality. Recent evidence suggests the key role of nucleotide-binding oligomerization domain-like receptor (NLR) family pyrin domain-containing 3 (NLRP3) inflammaosme activation on the pathogenesis of I/R injury.
Mehdi Farshchian et al.
Oncotarget, 8(28), 45825-45836 (2017-05-21)
Cutaneous squamous cell carcinoma (cSCC) is the most common metastatic skin cancer. Inflammation is a typical feature in cSCC progression. Analysis of the expression of inflammasome components in cSCC cell lines and normal human epidermal keratinocytes revealed upregulation of the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.