콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU015211

Sigma-Aldrich

MISSION® esiRNA

targeting human IVL

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GATGTCCCAGCAACACACACTGCCAGTGACCCTCTCCCCTGCCCTCAGTCAGGAGCTCCTCAAGACTGTTCCTCCTCCAGTCAATACCCATCAGGAGCAAATGAAACAGCCAACTCCACTGCCTCCCCCATGCCAGAAGGTGCCTGTCGAGCTCCCAGTGGAGGTCCCATCAAAGCAAGAGGAAAAGCACATGACTGCTGTAAAGGGACTGCCTGAGCAAGAATGTGAGCAACAGCAGAAGGAGCCACAGGAGCAGGAGCTGCAGCAACAGCACTGGGAACAGCATGAGGAATATCAGAAAGCAGAAAACCCAGAGCAGCAGCTTAAGCAGGAGAAAACACAAAGGGATCAGCAGCTAAACAAACAGCTGGAAGAAGAGAAGAAGCTCTTAGACCAGCAACTGGATCAAGAGCTAGTCAAGAGAGATGAGCAACTGGGAATGAAGAAAGAGCAACTGTTGGAGCTCCCAGAGCAGCAGGAGGGGCACCTGAAGCACCTAGAGCAGCAGGAG

Ensembl | 인체 수납 번호

ENSG00000163207

NCBI 수납 번호

NM_005547

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... IVL(3713) , IVL(3713)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Feng-Ning F Yuan et al.
International journal of oncology, 44(5), 1625-1633 (2014-03-15)
The secosteroidal hormone 1,25-dihyroxyvitamin D [1,25(OH)(2)D(3)] and its receptor, the vitamin D receptor (VDR), are crucial regulators of epidermal proliferation and differentiation. However, the effects of 1,25(OH)(2)D(3)-directed signaling on oral keratinocyte pathophysiology have not been well studied. We examined the
Roberta Lotti et al.
International journal of molecular sciences, 17(1) (2016-01-16)
Squamous Cell Carcinoma-derived Stem-like Cells (SCC-SC) originate from alterations in keratinocyte stem cells (KSC) gene expression and sustain tumor development, invasion and recurrence. Since survivin, a KSC marker, is highly expressed in SCC-SC, we evaluate its role in SCC-SC cell
Katiuscia Dallaglio et al.
International journal of molecular sciences, 14(10), 19540-19555 (2013-10-01)
In human epidermis, keratinocyte stem cells (KSC) are characterized by high levels of β1-integrin, resulting in the rapid adhesion to type IV collagen. Since epithelial tumors originate from KSC, we evaluated the features of rapidly adhering (RAD) keratinocytes derived from
Susanne Grether-Beck et al.
The Journal of investigative dermatology, 132(6), 1561-1572 (2012-03-16)
Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.