콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU014951

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRD1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCAATCAGAGAGATTCCAAGAAATATAGGAGAATTGAGAAATTTGGTTAGTTTACATGCATACAATAATCAAATAAGTTATCTTCCACCATCTTTGCTATCTTTAAATGATCTGCAGCAACTAAACCTGAGTGGAAATAATCTGACAGCTCTACCTAGTGCTATCTACAATATTTTTTCACTGAAGGAGATAAATTTTGATGACAACCCTTTGCTGAGACCTCCAGTGGAAATCTGTAAAGGAAAACAGTTGTATACTATTGCACGCTATCTACAGAGGGCAGATGAAAGAGATGAGAAAATTTTAGAGAAGATATTCAAGATAGTTGCCAACAACATCACTGAAACCAATTTTGAATTTTTATGTCAAAAACTAAACCTGGCAAACTCAGAAACTGATATGCCTACAAAGAGCACTGTTTCATTAAGTGAGAGAGCCCACCAAGCACTTGTTATATGGAAAACACAAAGTAACAAGTTATCACTAACTGCTGCTGCTTTAAGAGATCA

Ensembl | 인체 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Alexander J A Deutsch et al.
Cancer research, 77(9), 2375-2386 (2017-03-03)
Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
Xiao-Jun Feng et al.
British journal of pharmacology, 172(11), 2852-2863 (2015-01-28)
The orphan nuclear receptor NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, and is involved in glucose and fat metabolism. However, its potential contribution to cardiovascular diseases remains to be assessed. Here, the roles of NOR1

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.