콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU014831

Sigma-Aldrich

MISSION® esiRNA

targeting human BUB1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGACCCAGTTGATGGAAAGACTAAAGCCATCTATGCAGCACATGTTTATGAAGTTCTATTCTGCCCACTTATTCCAGAATGGCAGTGTATTAGTAGGAGAGCTCTACAGCTATGGAACATTATTAAATGCCATTAACCTCTATAAAAATACCCCTGAAAAAGTGATGCCTCAAGGTCTTGTCATCTCTTTTGCTATGAGAATGCTTTACATGATTGAGCAAGTGCATGACTGTGAAATCATTCATGGAGACATTAAACCAGACAATTTCATACTTGGAAACGGGCAAGTATTTTTGGAACAGGATGATGAAGATGATTTATCTGCTGGCTTGGCACTGATTGACCTGGGTCAGAGTATAGATATGAAACTTTTTCCAAAAGGAACTATATTCACAGCAAAGTGTGAAACATCTGGTTTTCAGTGTGTTGAGATGCTCAGCAACAAACCATGGAACTACCAGATCGATTACTTTGGGGTTGCTGCAACAGTATATTGCATGCTCTTTGGCAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Mathijs Vleugel et al.
Journal of cell science, 128(16), 2975-2982 (2015-07-08)
Mitotic chromosome segregation is initiated by the anaphase promoting complex/cyclosome (APC/C) and its co-activator CDC20 (forming APC/C(CDC20)). APC/C(CDC20) is inhibited by the spindle assembly checkpoint (SAC) when chromosomes have not attached to spindle microtubules. Unattached kinetochores catalyze the formation of
Yutaka Matsubara et al.
Shock (Augusta, Ga.), 51(3), 364-371 (2018-04-03)
Severe sepsis is critical to health and can result in acute renal failure (ARF). Tissue factor (TF) and thrombomodulin (TM) play key roles in vascular endothelial functions by helping maintain microcirculation in the kidney. Budding uninhibited by benzimidazole-1 (Bub1) plays
Katharina Overlack et al.
Current biology : CB, 27(19), 2915-2927 (2017-09-26)
The spindle assembly checkpoint (SAC) prevents premature sister chromatid separation during mitosis. Phosphorylation of unattached kinetochores by the Mps1 kinase promotes recruitment of SAC machinery that catalyzes assembly of the SAC effector mitotic checkpoint complex (MCC). The SAC protein Bub3
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.