설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTTCTAGCCCACCCTGTGACCCTGGGGGAGCAACAGTGGAAAAGCGAGAAACAACGAGAGGCAGAGCTCAAAAAGAAAAAACTAGAACAAAGATCAAAGCTTGAAAATTTAGAAGACCTTGAAATAATCATTCAACTGAAGAAAAGGAAAAAATACAGGAAAACTAAAGTTCCAGTTGTAAAGGAACCAGAACCTGAAATCATTACGGAACCTGTGGATGTGCCTACGTTTCTGAAGGCTGCTCTGGAGAATAAACTGCCAGTAGTAGAAAAATTCTTGTCAGACAAGAACAATCCAGATGTTTGTGATGAGTATAAACGGACAGCTCTTCATAGAGCATGCTTGGAAGGACATTTGGCAATTGTGGAGAAGTTAATGGAAGCTGGAGCCCAGATCGAATTCCGTGATATGCTTGAATCCACAGCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ANKRD1(27063) , ANKRD1(27063)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Adriana P Jiménez et al.
Oncotarget, 8(51), 88437-88452 (2017-11-29)
The Hippo pathway regulates organ size, growth and comprises several tumor related factors, including the oncoprotein YAP1 and the tumor suppressor RASSF1A.
Akiko Takahashi et al.
Scientific reports, 8(1), 14896-14896 (2018-10-07)
Overcoming acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) is critical in combating EGFR-mutant non-small cell lung cancer (NSCLC). We tried to construct a novel therapeutic strategy to conquer the resistance to second-and third-generation EGFR-TKIs in EGFR-positive
Fang Lu et al.
PloS one, 9(5), e97743-e97743 (2014-05-30)
The caspase-associated recruitment domain-containing protein (CARP) is expressed in almost all tissues. Recently, the tumor-suppressive function of CARP was discovered and attracted increasing attention. This study aimed to investigate the role of CARP in the carcinogenesis of human gastric carcinoma.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.