콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU013431

Sigma-Aldrich

MISSION® esiRNA

targeting human RAD18

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAGCAGGGGAGCAGGTTAATGGATAATTTCTTGATCAGAGAAATGAGTGGTTCTACATCAGAGTTGTTGATAAAAGAAAATAAAAGCAAATTCAGCCCTCAAAAAGAGGCGAGCCCTGCTGCAAAGACCAAAGAGACACGTTCTGTAGAAGAGATCGCTCCAGATCCCTCAGAGGCTAAGCGTCCTGAGCCACCCTCGACATCCACTTTGAAACAAGTTACTAAAGTGGATTGTCCTGTTTGCGGGGTTAACATTCCAGAAAGTCACATTAATAAGCATTTAGACAGCTGTTTATCACGCGAAGAGAAGAAGGAAAGCCTCAGAAGTTCTGTTCACAAAAGGAAGCCGCTGCCCAAAACTGTATATAATTTGCTCTCTGATCGTGATTTAAAGAAAAAGCTAAAAGAGCATGGATTATCTATTCAAGGAAATAAACAACAGCTCATTAAAAGGCACCAAGAATTTGTACACATGTACAATGCCCAATGCGATGCTTTGCATCCTAAATCAGCTGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chen Xie et al.
Journal of cellular physiology, 234(11), 21100-21112 (2019-05-14)
This study aimed at investigating the role of RAD18 in the regulation of glioblastoma development as well as the underlying mechanisms. The human glioblastoma U251 and U87MG cells were transfected with siRNAs specifically targeting RAD18, and the effects of knockdown
Megumi Sasatani et al.
PloS one, 10(2), e0117845-e0117845 (2015-02-13)
The ubiquitin ligase RAD18 is involved in post replication repair pathways via its recruitment to stalled replication forks, and its role in the ubiquitylation of proliferating cell nuclear antigen (PCNA). Recently, it has been reported that RAD18 is also recruited
Thomas Göhler et al.
The Journal of cell biology, 192(2), 219-227 (2011-01-19)
DNA polymerase η (polη) belongs to the Y-family of DNA polymerases and facilitates translesion synthesis past UV damage. We show that, after UV irradiation, polη becomes phosphorylated at Ser601 by the ataxia-telangiectasia mutated and Rad3-related (ATR) kinase. DNA damage-induced phosphorylation
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.