콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

추가 자료

EHU011991

Sigma-Aldrich

MISSION® esiRNA

targeting human FER

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GACACCTCATCATGGACACGCTACTTTAGCTAAGGCATGACCAGCAATGAACAGTAGTAAGATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAATGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGGAATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAGAATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAATGAATTATGTCAGCAACGTATCCAAGTCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCAGAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGA

Ensembl | 인체 수납 번호

ENSG00000151422

NCBI 수납 번호

NM_005246

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FER(2241) , FER(2241)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Joanna Stanicka et al.
Oncogene, 37(23), 3131-3150 (2018-03-16)
IGF-1 receptor (IGF-1R) and integrin cooperative signaling promotes cancer cell survival, proliferation, and motility, but whether this influences cancer progression and therapy responses is largely unknown. Here we investigated the non-receptor tyrosine adhesion kinase FES-related (FER), following its identification as

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.