콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU011171

Sigma-Aldrich

MISSION® esiRNA

targeting human CSNK2A2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jintaek Im et al.
Apoptosis : an international journal on programmed cell death, 24(5-6), 499-510 (2019-03-10)
Idiopathic pulmonary fibrosis (IPF) is a deadly and progressive fibrotic lung disease, but the precise etiology remains elusive. IPF is characterized by the presence of apoptosis-resistant (myo)fibroblasts that relentlessly produce a collagen-rich extracellular matrix (ECM). Recent studies showed that an
Hai Lu et al.
Neoplasia (New York, N.Y.), 16(10), 789-800 (2014-11-08)
Cancer stem cells (CSC) and genes have been linked to cancer development and therapeutic resistance, but the signaling mechanisms regulating CSC genes and phenotype are incompletely understood. CK2 has emerged as a key signal serine/threonine kinase that modulates diverse signal
Sung Won Lee et al.
PloS one, 11(11), e0166450-e0166450 (2016-11-17)
Although alpha (α)B-crystallin is expressed in articular chondrocytes, little is known about its role in these cells. Protein kinase casein kinase 2 (CK2) inhibition induces articular chondrocyte death. The present study examines whether αB-crystallin exerts anti-apoptotic activity in articular chondrocytes.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.