콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU010121

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATATAGTCGCTTTTCTTTGGAGAATAACTTCTTGCTACAGCATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATTTTCAGGAAGACCCAATCCAGATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGAAAACGCCCAGAGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAAGAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATCAAGAGCCTGGAAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGAGAACACGAGACCAATGGTGTGGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAGAAGATGTATTTAATGCTTGACAATAAGAGAAAGGAAGTAGTTCACAAAATAATAGAGTTGCTGAATGTCACTGAACTTACCCAGAATGCCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sophia Hatziieremia et al.
Molecular carcinogenesis, 55(11), 1667-1677 (2015-10-27)
STAT1 loss has previously been implicated in cell line studies to modify prostate cancer cell growth and survival, however the clinical significance of this has not previously been established. This study investigated if STAT1 loss was associated with patient outcome
Bin Huang et al.
Nature communications, 7, 13885-13885 (2016-12-15)
Communication between osteoblasts and endothelial cells (ECs) is essential for bone turnover, but the molecular mechanisms of such communication are not well defined. Here we identify Cxcl9 as an angiostatic factor secreted by osteoblasts in the bone marrow microenvironment. We
Lan-Juan Zhao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 40(1-2), 77-90 (2016-11-18)
Signal transducer and activator of transcription (STAT) pathway plays an important role in antiviral efficacy of interferon alpha (IFN-α). IFN-α is the main therapeutic against hepatitis C virus (HCV) infection. We explored effects of IFN-α on HCV replication and antiviral
Yonglei Liu et al.
Oncotarget, 8(24), 39559-39570 (2017-05-04)
Carcinoma associated fibroblasts (CAFs) play important roles in breast cancer development and progression. Recent studies show that microRNAs (miRNAs) are the main regulators in CAFs. MiR-29b is one of the significant down-regulated miRNAs in CAFs from the miRNA screening. The
Makoto Fujii et al.
World journal of gastroenterology, 23(30), 5519-5529 (2017-08-31)
To investigate interleukin (IL)-26 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and the function of IL-26. Human colonic subepithelial myofibroblasts (SEMFs) were isolated from colon tissue surgically resected. The expression of IL-26 protein and its

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.