콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU009691

Sigma-Aldrich

MISSION® esiRNA

targeting human RND3

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGAGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAACAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC

Ensembl | 인체 수납 번호

ENSG00000115963

NCBI 수납 번호

NM_005168

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RND3(390) , RND3(390)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chen Jiang et al.
Cancer research, 80(10), 1957-1969 (2020-02-16)
Nasopharyngeal carcinoma is an Epstein-Barr virus (EBV)-related malignancy. Recently, we found that the EBV-encoded miRNA BART2-5p was increased in the serum of patients with preclinical nasopharyngeal carcinoma and that the copy number positively correlated with disease progression. In this study
Marta Hernández-Sánchez et al.
Oncotarget, 6(19), 17479-17490 (2015-06-04)
RhoE is a small GTPase involved in the regulation of actin cytoskeleton dynamics, cell cycle and apoptosis. The role of RhoE in cancer is currently controversial, with reports of both oncogenic and tumor-suppressive functions for RhoE. Using RhoE-deficient mice, we
Kim Clarke et al.
PLoS genetics, 11(7), e1005325-e1005325 (2015-07-02)
Gliomas are a highly heterogeneous group of brain tumours that are refractory to treatment, highly invasive and pro-angiogenic. Glioblastoma patients have an average survival time of less than 15 months. Understanding the molecular basis of different grades of glioma, from

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.