콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU009611

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGAGCGACCCTCACATCAAGCTACAACTTCAAGCAGAAGAGAGAGGAGTTGTGTCTATCAAAGGAGTGTGTGCTAACCGTTACCTGGCTATGAAGGAAGATGGAAGATTACTGGCTTCTAAATGTGTTACGGATGAGTGTTTCTTTTTTGAACGATTGGAATCTAATAACTACAATACTTACCGGTCAAGGAAATACACCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTTGGATCCAAAACAGGACCTGGGCAGAAAGCTATACTTTTTCTTCCAATGTCTGCTAAGAGCTGATTTTAATGGCCACATCTAATCTCATTTCACATGAAAGAAGAAGTATATTTTAGAAATTTGTTAATGAGAGTAAAAGAAAATAAATGTGTATAGCTCAGTTTGGATAATTGGTCAAACAATTTTTTATCCAGTAGTAAAATATGTAACCATTGTCCCAGTAAAGAAAAATAACAAAAGTTGTAAAATGTATATTCTCCCTTTTATATTGCATCTGCTGTTACCCAG

Ensembl | 인체 수납 번호

ENSG00000138685

NCBI 수납 번호

NM_002006

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... FGF2(2247) , FGF2(2247)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
LWT
CIS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaori Huang et al.
Oncology letters, 17(3), 3425-3431 (2019-03-15)
Increasing number of microRNAs (miRNAs) have been reported to play an important role in the development and progression of non-small cell lung cancer (NSCLC). In particular, microRNA-497-5p (miR-497-5p) has been proposed as a tumor suppressor miRNA in human cancers. However
Hongxue Wu et al.
Biochemical and biophysical research communications, 514(3), 933-939 (2019-05-16)
Cancer-associated fibroblasts comprise the major stromal cell populations in gastric cancer, which is a significant contributor to cancer-related death worldwide. As a member of the serine protease family, HTRA1 is reportedly involved in malignant transformation of various tumor types. In
Long He et al.
Journal of cancer research and therapeutics, 14(7), 1519-1524 (2018-12-28)
The objective of the study is to investigate the role of basic fibroblast growth factor (bFGF) in sensitivity to cisplatin in non-small cell lung cancer (NSCLC) A549 cells and its effect on the stemness characteristics of NSCLC cells, revealing possible
Yantao Han et al.
Cell biology international, 41(12), 1296-1306 (2017-08-10)
Vascular smooth muscle cell (VSMC) proliferation is a major contributor to atherosclerosis. This study investigated the inhibitory effects of oleanolic acid (OA) against oxidized low-density lipoprotein (ox-LDL)-induced VSMC proliferation in A7r5 cells and explored underlying molecular mechanism. The cell proliferation
Ana M Ruiz Lopez et al.
The European journal of neuroscience, 46(1), 1663-1672 (2017-05-12)
Retinitis pigmentosa (RP) is a group of hereditary retinal diseases, characterised by photoreceptor cell loss. Despite a substantial understanding of the mechanisms leading to cell death, an effective therapeutic strategy is sought. Our laboratory has previously demonstrated the neuroprotective properties
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.