콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU008861

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ACAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAGGATCTCATAGATCAGAACATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAAGAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCAGAGGGTGCCCCAGAGGGATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAGGCAATGGACATAATATATGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTCTGTTGTTGCATCGGCTCAGGTTGTGGAGGGGACCCCAAGTGCATGGACAGGGTGTGTTTCTGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAA

Ensembl | 인체 수납 번호

ENSG00000104689

NCBI 수납 번호

NM_003844

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TNFRSF10A(8797) , TNFRSF10A(8797)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yitong Yang et al.
The international journal of biochemistry & cell biology, 97, 62-72 (2018-02-13)
Persistent infection with hepatitis B virus (HBV) may lead to HBV-associated glomerulonephritis (HBV-GN). Presence of HBV-DNA and -RNA in renal tubular epithelial cells (RTECs) suggests direct virus-induced injury. Increase in proinflammatory cytokines is also observed under these conditions. Apoptosis by
Yuyou Deng et al.
International journal of biological sciences, 15(3), 688-700 (2019-02-13)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an effective chemotherapeutic agent that specifically impairs cancer cells while sparing normal cells; however, some cancer cells develop resistance to TRAIL. Here, we identified Andrographolide, a diterpenoid lactone derived from a traditional herbal
Bo Ram Kim et al.
Oncogene, 38(20), 3903-3918 (2019-01-30)
RUNX3 is frequently inactivated by DNA hypermethylation in numerous cancers. Here, we show that RUNX3 has an important role in modulating apoptosis in immediate response to tumor necrosis factor-related apoptosis-including ligand (TRAIL). Importantly, no combined effect of TRAIL and RUNX3
Jae Young Jang et al.
PloS one, 9(6), e98171-e98171 (2014-06-14)
Hepatitis C virus (HCV) infection causes chronic liver diseases leading to hepatocellular carcinoma (HCC) and liver failure. We have previously shown that HCV sensitizes hepatocytes to mitochondrial apoptosis via the TRAIL death receptors DR4 and DR5. Although TRAIL and its
Mamoru Akita et al.
International journal of oncology, 45(5), 1901-1912 (2014-09-02)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising candidate for cancer treatment, but some cancer cell types are resistant to TRAIL cytotoxicity. Therefore, overcoming this resistance is necessary for effective TRAIL therapy. Mitochondrial morphology is important for the maintenance

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.