콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU008731

Sigma-Aldrich

MISSION® esiRNA

targeting human NR4A2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCAGTGGAGGGTAAACTCATCTTTTGCAATGGGGTGGTCTTGCACAGGTTGCAATGCGTTCGTGGCTTTGGGGAATGGATTGATTCCATTGTTGAATTCTCCTCCAACTTGCAGAATATGAACATCGACATTTCTGCCTTCTCCTGCATTGCTGCCCTGGCTATGGTCACAGAGAGACACGGGCTCAAGGAACCCAAGAGAGTGGAAGAACTGCAAAACAAGATTGTAAATTGTCTCAAAGACCACGTGACTTTCAACAATGGGGGGTTGAACCGCCCCAATTATTTGTCCAAACTGTTGGGGAAGCTCCCAGAACTTCGTACCCTTTGCACACAGGGGCTACAGCGCATTTTCTACCTGAAATTGGAAGACTTGGTGCCACCGCCAGCAATAATTGACAAACTTTTCCTGGACACTTTACCTTTCTAAGACCTCCTCCCAAGCACTTCAAAGGAACTGGAATGATAATGGAAACTGTCAAGAGGGGGCAAGTCACATGGGCAGAGATAGCCGTGTGAGCAGTCTCAGCTC

Ensembl | 인체 수납 번호

ENSG00000153234

NCBI 수납 번호

NM_006186

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NR4A2(4929) , NR4A2(4929)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shawn Llopis et al.
BMC cancer, 13, 139-139 (2013-03-23)
NR4A orphan nuclear receptors are involved in multiple biological processes which are important in tumorigenesis such as cell proliferation, apoptosis, differentiation, and glucose utilization. The significance of NR4A family member NURR1 (NR4A2) in breast cancer etiology has not been elucidated.
Hye-Sun Lim et al.
Oxidative medicine and cellular longevity, 2019, 5797512-5797512 (2019-11-28)
Parkinson's disease (PD) is characterized by dopaminergic neuronal loss in the substantia nigra pars compacta (SNPC) and the striatum. Nuclear receptor-related 1 protein (Nurr1) is a nuclear hormone receptor implicated in limiting mitochondrial dysfunction, apoptosis, and inflammation in the central
Xin Heng et al.
Molecular neurodegeneration, 7, 4-4 (2012-02-03)
NURR1 (also named as NR4A2) is a member of the steroid/thyroid hormone receptor family, which can bind to DNA and modulate expression of target genes. Previous studies have shown that NURR1 is essential for the nigral dopaminergic neuron phenotype and
S Loppi et al.
Brain, behavior, and immunity, 73, 670-681 (2018-08-01)
Ischemic stroke is amongst the leading causes of death and disabilities. The available treatments are suitable for only a fraction of patients and thus novel therapies are urgently needed. Blockage of one of the cerebral arteries leads to massive and
Hiroki Shimada et al.
FEBS open bio, 7(9), 1410-1421 (2017-09-15)
Aldosterone synthase is the key rate-limiting enzyme in adrenal aldosterone production, and induction of its gene (
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.