콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU008611

Sigma-Aldrich

MISSION® esiRNA

targeting human IFIH1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTGCATGGAGGAGGAACTGTTGACAATTGAAGACAGAAACCGGATTGCTGCTGCAGAAAACAATGGAAATGAATCAGGTGTAAGAGAGCTACTAAAAAGGATTGTGCAGAAAGAAAACTGGTTCTCTGCATTTCTGAATGTTCTTCGTCAAACAGGAAACAATGAACTTGTCCAAGAGTTAACAGGCTCTGATTGCTCAGAAAGCAATGCAGAGATTGAGAATTTATCACAAGTTGATGGTCCTCAAGTGGAAGAGCAACTTCTTTCAACCACAGTTCAGCCAAATCTGGAGAAGGAGGTCTGGGGCATGGAGAATAACTCATCAGAATCATCTTTTGCAGATTCTTCTGTAGTTTCAGAATCAGACACAAGTTTGGCAGAAGGAAGTGTCAGCTGCTTAGATGAAAGTCTTGGACATAACAGCAACATGGGCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seung Bum Park et al.
PloS one, 11(7), e0158419-e0158419 (2016-07-13)
Hepatitis C virus (HCV) actively evades host interferon (IFN) responses but the mechanisms of how it does so are not completely understood. In this study, we present evidence for an HCV factor that contributes to the suppression of retinoic-acid-inducible gene-I
Shogo Kawaguchi et al.
Inflammation, 42(6), 2095-2104 (2019-08-24)
The molecular mechanisms of innate immunity are closely associated with the development of non-alcoholic fatty liver disease (NAFLD). TNF-α is a key cytokine involved in the pathogenesis of metabolic inflammation like NAFLD. Melanoma differentiation-associated gene 5 (MDA5) is a member
Chia-Lin Chen et al.
Nature communications, 8, 13882-13882 (2017-01-10)
B-cell infection by hepatitis C virus (HCV) has been a controversial topic. To examine whether HCV has a genetically determined lymphotropism through a co-receptor specific for the infection by lymphotropic HCV, we established an infectious clone and chimeric virus of
Iwona A Buskiewicz et al.
Science signaling, 9(456), ra115-ra115 (2016-12-03)
The increased expression of genes induced by type I interferon (IFN) is characteristic of viral infections and systemic lupus erythematosus (SLE). We showed that mitochondrial antiviral signaling (MAVS) protein, which normally forms a complex with retinoic acid gene I (RIG-I)-like
Tongtian Zhuang et al.
Cell death & disease, 11(6), 453-453 (2020-06-14)
Vitiligo is a disfiguring disease featuring chemokines-mediated cutaneous infiltration of autoreactive CD8+ T cells that kill melanocytes. Copious studies have indicated that virus invasion participates in the pathogenesis of vitiligo. IFIH1, encoding MDA5 which is an intracellular virus sensor, has

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.