콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU007651

Sigma-Aldrich

MISSION® esiRNA

targeting human PDK4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGAGACTCGCCAACATTCTGAAGGAAATTGATATCCTCCCGACCCAATTAGTAAATACCTCTTCAGTGCAATTGGTTAAAAGCTGGTATATACAGAGCCTGATGGATTTGGTGGAATTCCATGAGAAAAGCCCAGATGACCAGAAAGCATTATCAGACTTTGTAGATACACTCATCAAAGTTCGAAATAGACACCATAATGTAGTCCCTACAATGGCACAAGGAATCATAGAGTATAAAGATGCCTGTACAGTTGACCCAGTCACCAATCAAAATCTTCAATATTTCTTGGATCGATTTTACATGAACCGTATTTCTACTCGGATGCTGATGAACCAGCACATTCTTATATTTAGTGACTCACAGACAGGAAACCCAAGCCACATTGGAAGCATTGATCCTAACTGTGATGTGGTAGCAGTGGTCCAAGATGCCTTTGAGTGTTCAAGGATGCTCTGTGATCAGTATTATTTATCATCTCCAGAATTAAAGCTTACACAAGTGAATGGAAAATTTCCAGACCAACCAATTCACA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

D Leclerc et al.
British journal of cancer, 116(7), 930-936 (2017-02-17)
Cancer cells maintain high rates of glycolysis. Pyruvate dehydrogenase kinases (PDK) contribute to this phenomenon, which favours apoptosis resistance and cellular transformation. We previously reported upregulation of PDK4 in normal mucosa of colorectal cancer (CRC) patients compared with controls and
Yongchang Miao et al.
Cancer medicine, 9(19), 7231-7243 (2020-08-12)
Gastric cancer (GC) is one of the most deadly malignancies at global scale, and is particularly common in eastern Asia. MicroRNA-5683 (miR-5683) was confirmed to be downregulated in GC by analyzing data from the Cancer Genome Atlas. We packaged miR-5683-mimics
Xiaohui Liu et al.
Scientific reports, 7(1), 8474-8474 (2017-08-18)
Pyruvate dehydrogenase kinase (PDK) is known as a gatekeeper directing the carbon flux into glycolysis via inhibition of the pyruvate dehydrogenase complex. During syncytialization of placental trophoblasts, both ATP production and oxygen consumption are increased to meet enhanced energetic demands
Yukihiro Tambe et al.
Molecular carcinogenesis, 58(10), 1726-1737 (2019-05-21)
Phosphorylation of pyruvate dehydrogenase by pyruvate dehydrogenase kinase 4 (PDK4) 4 inhibits its ability to induce a glycolytic shift. PDK4 expression is frequently upregulated in various cancer tissues, with its elevation being critical for the induction of the Warburg effect.
Peng Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(7), 3924-3935 (2018-03-06)
Prostate cancer (PCa) represents one of the most common solid neoplasms, and metastasis is the second leading cause of death in adult males. Anoikis is a programmed cell death that is induced upon cell detachment from the extracellular matrix (ECM)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.