콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU007001

Sigma-Aldrich

MISSION® esiRNA

targeting human DSP

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGAAGTCGTTGTTGGCCACTATGAAGACAGAACTACAGAAAGCCCAGCAGATCCACTCTCAGACTTCACAGCAGTATCCACTTTATGATCTGGACTTGGGCAAGTTCGGTGAAAAAGTCACACAGCTGACAGACCGCTGGCAAAGGATAGATAAACAGATCGACTTTAGGTTATGGGACCTGGAGAAACAAATCAAGCAATTGAGGAATTATCGTGATAACTATCAGGCTTTCTGCAAGTGGCTCTATGATGCTAAACGCCGCCAGGATTCCTTAGAATCCATGAAATTTGGAGATTCCAACACAGTCATGCGGTTTTTGAATGAGCAGAAGAACTTGCACAGTGAAATATCTGGCAAACGAGACAAATCAGAGGAAGTACAAAAAATTGCTGAACTTTGCGCCAATTCAATTAAGGATTATGAGCTCCAGCTGGC

Ensembl | 인체 수납 번호

ENSG00000096696

NCBI 수납 번호

NM_004415

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DSP(1832) , DSP(1832)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
NLS
JRR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Haiyong Wang et al.
Aging, 11(17), 6657-6673 (2019-09-05)
Long non-coding RNAs (lncRNAs) have been implicated in the pathogenesis of gastric cancer; however, their mechanisms of action remain largely unknown. The aim of this study was to identify lncRNAs involved in the tumorigenesis of gastric cancer and to investigate
Peipei Li et al.
International journal of biological sciences, 15(11), 2350-2362 (2019-10-09)
The interaction between genomic DNA and protein fundamentally determines the activity and the function of DNA elements. Capturing the protein complex and identifying the proteins associated with a specific DNA locus is difficult. Herein, we employed CRISPR, the well-known gene-targeting
Aritro Nath et al.
Molecular cancer research : MCR, 19(2), 240-248 (2020-10-28)
Elevated uptake of saturated fatty acid palmitate is associated with metastatic progression of cancer cells; however, the precise signaling mechanism behind the phenomenon is unclear. The loss of cell adhesion proteins, such as desmoplakin (DSP), is a key driving event
Dipal M Patel et al.
The Journal of cell biology, 206(6), 779-797 (2014-09-17)
Mechanisms by which microtubule plus ends interact with regions of cell-cell contact during tissue development and morphogenesis are not fully understood. We characterize a previously unreported interaction between the microtubule binding protein end-binding 1 (EB1) and the desmosomal protein desmoplakin
Johan Sternemalm et al.
PloS one, 10(8), e0134789-e0134789 (2015-08-05)
Deleterious mutations of the Centrosome/Spindle Pole associated Protein 1 gene, CSPP1, are causative for Joubert-syndrome and Joubert-related developmental disorders. These disorders are defined by a characteristic mal-development of the brain, but frequently involve renal and hepatic cyst formation. CSPP-L, the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.