설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGATCGCCTGATGAACCAATTGATAGACCCATCAGACATCGATGAGTCATCAGTGATGCAGCTGGCCGAGATGGGTTTCCCGCTGGAAGCATGTCGCAAGGCTGTGTACTTCACTGGAAATATGGGCGCCGAGGTGGCCTTCAACTGGATCATTGTTCACATGGAAGAGCCAGATTTTGCTGAGCCGCTGACCATGCCTGGTTATGGAGGGGCAGCTTCTGCTGGAGCCTCTGTTTTTGGTGCTTCTGGACTGGATAACCAACCTCCAGAGGAAATCGTAGCTATCATCACCTCCATGGGATTTCAGCGAAATCAGGCTATTCAGGCACTACGAGCAACGAATAATAACCTGGAAAGAGCACTGGATTGGATCTTTAGCCACCCTGAGTTTGAAGAAGACAGTGATTTTGTGATTGAGATGGAGAATAATGCCAATGCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... USP13(8975) , USP13(8975)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Amplification of USP13 drives non-small cell lung cancer progression mediated by AKT/MAPK signaling.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 114, 108831-108831 (2019-04-16)
USP13 is emerging as a potential target in cancer therapy. However, the effect of USP13 on tumor progression is controversial. Here we focused on non-small cell lung cancer (NSCLC), a common cancer with high mortality, and studied the role of
Journal of experimental & clinical cancer research : CR, 38(1), 157-157 (2019-04-13)
Prostate cancer (PCa) remains a challenge worldwide. Due to the development of castration-resistance, traditional first-line androgen deprivation therapy (ADT) became powerlessness. Epidermal growth factor receptor (EGFR) is a well characterized therapeutic target to treat colorectal carcinoma and non-small cell lung
The Journal of experimental medicine, 214(1), 245-267 (2016-12-08)
Glioblastoma is the most lethal brain tumor and harbors glioma stem cells (GSCs) with potent tumorigenic capacity. The function of GSCs in tumor propagation is maintained by several core transcriptional regulators including c-Myc. c-Myc protein is tightly regulated by posttranslational
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.