콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU003471

Sigma-Aldrich

MISSION® esiRNA

targeting human SRF

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Ensembl | 인체 수납 번호

ENSG00000112658

NCBI 수납 번호

NM_003131

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SRF(6722) , SRF(6722)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
OTU
LSU
KGS
KAS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hui Liu et al.
Stem cells international, 2016, 2524092-2524092 (2016-01-23)
Resveratrol (trans-3,5,4'-trihydroxystilbene) (RSV) is a natural polyphenol with protective effects over cardiac tissues and can affect cell survival and differentiation in cardiac stem cells transplantation. However, whether this agent can affect cardiomyocytes (CMs) differentiation of induced pluripotent stem cells (iPSCs)
Carolina Leimgruber et al.
Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)
Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures
Qi Li et al.
PloS one, 8(9), e75470-e75470 (2013-09-24)
Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct
Min-Seok Kim et al.
Scientific reports, 9(1), 4631-4631 (2019-03-16)
Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically
Xi He et al.
Oncology letters, 5(3), 819-824 (2013-02-22)
Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.