콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

View All Documentation

EHU002981

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF3A

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCTGTCAGTGTGGATGAGATGAGGGGAACTATCACTGTACATAAGACTGATTCTTCCAATGAACCTCCAAAGACATTTACTTTTGATACTGTTTTTGGACCAGAGAGTAAACAACTTGATGTTTATAACTTAACTGCAAGACCTATTATTGATTCTGTACTTGAAGGCTACAATGGGACTATTTTTGCATATGGACAAACCGGAACAGGCAAAACTTTTACCATGGAAGGTGTTCGAGCTATTCCTGAACTTAGAGGAATAATTCCCAATTCATTTGCTCACATATTTGGTCATATTGCAAAAGCGGAGGGTGATACAAGATTTTTGGTTCGAGTGTCTTATTTGGAAATATATAATGAAGAAGTTCGTGACCTTTTGGGCAAGGATCAGACACAAAGGTTAGAGGTTAAAGAAAGACCTGATGTGGGAGTTTATATCAAAGATTTATCAGCTTATGTGGTAAATAATGCTGATGATATGGATAGAATTATGACGCTAGGCCACAAAAATCGTTCTGTTGGTGCAACTAATATGAACGAACATAGTTCCCGTTCCCATG

Ensembl | 인체 수납 번호

ENSG00000131437

NCBI 수납 번호

NM_007054

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KIF3A(11127) , KIF3A(11127)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Loren Masterson et al.
Journal of skin cancer, 2014, 596459-596459 (2014-03-19)
Due to the rarity of Merkel cell carcinoma (MCC), prospective clinical trials have not been practical. This study aimed to identify biomarkers with prognostic significance. While sixty-two patients were identified who were treated for MCC at our institution, only seventeen
Premkumar Vummidi Giridhar et al.
Journal of immunology (Baltimore, Md. : 1950), 197(11), 4228-4239 (2016-11-01)
KIF3A, the gene encoding kinesin family member 3A, is a susceptibility gene locus associated with asthma; however, mechanisms by which KIF3A might influence the pathogenesis of the disorder are unknown. In this study, we deleted the mouse Kif3a gene in
Anne-Clémence Vion et al.
The Journal of cell biology, 217(5), 1651-1665 (2018-03-04)
Blood flow shapes vascular networks by orchestrating endothelial cell behavior and function. How endothelial cells read and interpret flow-derived signals is poorly understood. Here, we show that endothelial cells in the developing mouse retina form and use luminal primary cilia
Don-Marc Franchini et al.
Cell reports, 26(1), 94-107 (2019-01-04)
Despite the clinical success of blocking inhibitory immune checkpoint receptors such as programmed cell death-1 (PD-1) in cancer, the mechanisms controlling the expression of these receptors have not been fully elucidated. Here, we identify a post-transcriptional mechanism regulating PD-1 expression

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.