콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU002941

Sigma-Aldrich

MISSION® esiRNA

targeting human SPARC

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACGGGTACCTCTCCCACACCGAGCTGGCTCCACTGCGTGCTCCCCTCATCCCCATGGAGCATTGCACCACCCGCTTTTTCGAGACCTGTGACCTGGACAATGACAAGTACATCGCCCTGGATGAGTGGGCCGGCTGCTTCGGCATCAAGCAGAAGGATATCGACAAGGATCTTGTGATCTAAATCCACTCCTTCCACAGTACCGGATTCTCTCTTTAACCCTCCCCTTCGTGTTTCCCCCAATGTTTAAAATGTTTGGATGGTTTGTTGTTCTGCCTGGAGACAAGGTGCTAACATAGATTTAAGTGAATACATTAACGGTGCTAAAAATGAAAATTCTAACCCAAGACATGACATTCTTAGCTGTAACTTAACTATTAAGGCCTTTTCCACACGCATTAATAGTCCCATTTTTCTCTTGCCATTTGTAGCTTTGCCCAT

Ensembl | 인체 수납 번호

ENSG00000113140

NCBI 수납 번호

NM_003118

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SPARC(6678) , SPARC(6678)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
XJU
WNS
PYR
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jing Zhu et al.
Stem cells (Dayton, Ohio), 38(1), 134-145 (2019-10-24)
The purpose of this study was to investigate the effects of secreted protein acidic and rich in cysteine (SPARC) on the maintenance of limbal epithelial stem cell (LESC) stemness and restoration of ocular surface. To determine the suitable concentration of
Jijun Fu et al.
Carcinogenesis, 38(6), 649-660 (2017-05-13)
Oncogene c-Myc is frequently amplified and activated in human cancers. Deregulation of c-Myc protein has been shown to occur in 30% of all human cancers, especially in hematopoietic malignancies. As a transcription factor, c-Myc has been shown to regulate up
Cho Rong Park et al.
Theranostics, 9(24), 7447-7457 (2019-11-07)
Human serum albumin (HSA) is the most abundant plasma protein. The main reason for using HSA as a versatile tool for drug delivery is based on its ability to accumulate in tumors. However, the mechanism of albumin accumulation in tumors
Katrina Viloria et al.
Scientific reports, 6, 37839-37839 (2016-11-26)
SPARC is a matricellular protein that is involved in both pancreatic cancer and diabetes. It belongs to a wider family of proteins that share structural and functional similarities. Relatively little is known about this extended family, but evidence of regulatory
Parul Choudhary et al.
PloS one, 10(6), e0130379-e0130379 (2015-06-30)
The integrity of the epithelium is maintained by a complex but regulated interplay of processes that allow conversion of a proliferative state into a stably differentiated state. In this study, using human embryonic stem cell (hESC) derived Retinal Pigment Epithelium
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.