설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAAAACCAGAGGGGAGCAAAATCGATGCAGTGCTTCCAAGGATGGACCACACAGAGGCTGCCTCTCCCATCACTTCCCTACATGGAGTATATGTCAAGCCATAATTGTTCTTAGTTTGCAGTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGCTGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATCCTAAGCTATTCAGTAATAACTCTACCCTGGCACTATAATGTAAGCTCTACTGAGGTGCTATGTTCTTAGTGGATGTTCTGACCCTGCTTCAAATATTTCCCTCACCTTTCCCATCTTCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CXCL10(3627) , CXCL10(3627)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yi Fu et al.
International immunopharmacology, 75, 105783-105783 (2019-08-04)
Myrothecine A, characterized from the extracts of myrothecium roridum strain IFB-E012, isolated as endophytic fungi found in the traditional Chinese medicinal plant Artemisia annua. Here we investigated its roles on anti-tumor and immune regulation in vitro. Dendritic cells (DCs) are
Xiuming Wu et al.
Molecular and cellular endocrinology, 512, 110866-110866 (2020-05-18)
Although 70% of estrogen receptor (ER)-positive breast cancer patients can benefit from tamoxifen therapy, the rapid development of tamoxifen resistance hampers the treatment advantage. In this investigation, we found that the serum level of CXCL10 in breast cancer patients was
Katrina K Au et al.
Gynecologic oncology, 145(3), 436-445 (2017-03-21)
We recently established that high STAT1 expression and associated T helper type I tumour immune microenvironment (TME) are prognostic and chemotherapy response predictive biomarkers in high-grade serous ovarian cancer (HGSC). STAT1 induced chemokine CXCL10 is key to the recruitment of
Jon Cogan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 22(10), 1741-1752 (2014-08-27)
Patients with recessive dystrophic epidermolysis bullosa (RDEB) have severe, incurable skin fragility, blistering, and multiple skin wounds due to mutations in the gene encoding type VII collagen (C7), the major component of anchoring fibrils mediating epidermal-dermal adherence. Nearly 10-25% of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.