Skip to Content
Merck
All Photos(1)

Key Documents

EHU147971

Sigma-Aldrich

MISSION® esiRNA

targeting human MIF

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTGGTGTCCGAGAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGGGCTGGAACAACTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Zhang et al.
Clinical and experimental pharmacology & physiology, 43(11), 1134-1144 (2016-10-21)
Macrophage migration inhibitory factor (MIF), a pleiotropic pro-inflammatory cytokine, is a key regulator in both innate and acquired immunity systems. MIF has become a promising drug target for inflammatory diseases. Apart from its cytokine activities, MIF is known to act
Mei Zhang et al.
Molecular carcinogenesis, 58(6), 898-912 (2019-01-23)
Macrophage migration inhibitory factor (MIF) is a prominent orchestrator during the onset and progression of cancer. Recently, MIF was detected in salivary adenoid cystic carcinoma (SACC). However, its functional effect in perineural invasion (PNI) of SACC remained unknown. To illuminate
Mi Jeong Kim et al.
Cellular signalling, 34, 110-120 (2017-03-23)
The nuclear factor kappa B (NF-κB) pathway is pivotal in controlling survival and apoptosis of cancer cells. Macrophage migration inhibitory factor (MIF), a cytokine that regulates the immune response and tumorigenesis under inflammatory conditions, is upregulated in various tumors. However
Huihua Yuan et al.
Acta biomaterialia, 42, 247-257 (2016-07-03)
Stiffness of biomaterial substrates plays a critical role in regulation of cell behavior. Although the effect of substrate stiffness on cell behavior has been extensively studied, molecular mechanisms of regulation rather than those involving cytoskeletal activities still remain elusive. In
Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service