Skip to Content
Merck
All Photos(1)

Key Documents

EHU081851

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPT2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG

Ensembl | human accession no.

ENSG00000091879

NCBI accession no.

NM_001147

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ANGPT2(285) , ANGPT2(285)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Jing Xu et al.
American journal of physiology. Cell physiology, 313(3), C262-C273 (2017-06-24)
Angiopoietin-2 (Ang-2) contributes to vascular hyporeactivity after hemorrhagic shock and hypoxia through upregulation of inducible nitric oxide synthase (iNOS) in a vascular endothelial cell (VEC)-specific and Ang-2/Tie2 receptor-dependent manner. While iNOS is primarily expressed in vascular smooth muscle cells (VSMCs)
Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service