Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

Safety Information

NCSTUD001

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor

ath-miR416, Negative Control 1, Sequence from Arabidopsis thaliana with no homology to human and mouse gene sequences

Synonym(s):

Synthetic Tough Decoy, sTuD

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
12352200
NACRES:
NA.51

product line

MISSION®

form

solid

mature sequence

GGUUCGUACGUACACUGUUCA

Sanger mature/minor accession no.

MIMAT0001324

Sanger microRNA accession no.

MI0001427

storage temp.

−20°C

Looking for similar products? Visit Product Comparison Guide

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Pictograms

Health hazard
GHS08

Signal Word

Warning

Hazard Statements

H373

Precautionary Statements

P260 - P314 - P501

Hazard Classifications

STOT RE 2 Inhalation

Target Organs

Respiratory Tract

Storage Class Code

11 - Combustible Solids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

PRTR

Class I Designated Chemical Substances

JAN Code

NCSTUD001:

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ilker Tinay et al.
The Prostate, 78(12), 927-937 (2018-05-12)
MicroRNAs (miRNAs) are small non-coding RNAs, which negatively regulate gene expression and impact prostate cancer (PCa) growth and progression. Circulating miRNAs are stable and detectable in cell-free body fluids, such as serum. Investigation of circulating miRNAs presents great potential in
Qing-Yan Lin et al.
Biotechnology letters, 42(1), 35-44 (2019-11-25)
The study is to research how miR-34-SIRT1 is regulated during hypoxia in lung cancer cells. Analysis of publicly available datasets from patients with NSCLC did not reveal significant genomic alterations in RBM38, SIRT1, HIF1A, MIR34A, MIR34B, and MIR34C, but expectedly
Yao Dai et al.
Redox biology, 16, 255-262 (2018-03-20)
Several miR/s that regulate gene/s relevant in atherogenesis are being described. We identified a miR (miR-98) that targets LOX-1, a receptor for ox-LDL, and speculated that it might be relevant in atherogenesis. MicroRNA-98 was predicted by bioinformatics tools. The effects
Anumeha Singh et al.
The EMBO journal, 38(16), e100727-e100727 (2019-07-23)
Translational readthrough generates proteins with extended C-termini, which often possess distinct properties. Here, we have used various reporter assays to demonstrate translational readthrough of AGO1 mRNA. Analysis of ribosome profiling data and mass spectrometry data provided additional evidence for translational

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service