Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EMU195961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Srebf2

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCTGACCACAATGCCTGTGATGATGGGGCAAGAGAAAGTTCCTATCAAGCAAGTGCCTGGCGGCGTGAAGCAGCTGGATCCTCCCAAAGAAGGAGAGAGGCGGACAACACACAATATCATTGAAAAGCGCTACCGGTCCTCCATCAACGACAAAATCATAGAGTTGAAGGACTTAGTCATGGGGACAGATGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATATCTGCAGCAGGTCAATCACAAGCTGCGCCAGGAGAACATGGTGCTGAAGCTGGCCAATCAGAAAAACAAGCTCCTGAAGGGCATCGACCTGGGCAGTCTGGTGGACAGTGATGTGGACTTGAAAATTGATGACTTTAACCAGAATGTCCTTCTGATGTCTCCGCCGGCCTCCGACTCCGGGTCCCAGGCCGGCTTCTCTCCCTATTCCATTGACTCTGAGCCGGGCAGCCCTCTGCTGGATGACGCAAAGGTCAAGGATGAACC

Ensembl | mouse accession no.

ENSMUSG00000022463

NCBI accession no.

NM_033218

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... SREBF2(20788) , Srebf2(20788)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EMU195961-50UG:
EMU195961-20UG:

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Ji Miao et al.
Nature communications, 6, 6498-6498 (2015-04-08)
Despite the well-documented association between insulin resistance and cardiovascular disease, the key targets of insulin relevant to the development of cardiovascular disease are not known. Here, using non-biased profiling methods, we identify the enzyme flavin-containing monooxygenase 3 (Fmo3) to be
Kazuki Inoue et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 29(8), 1823-1832 (2014-03-29)
Clarification of the mechanisms underlying osteoclast differentiation enables us to understand the physiology of bone metabolism as well as the pathophysiology of bone diseases such as osteoporosis. Recently, it has been reported that epigenetics can determine cell fate and regulate
Kenji Fukui et al.
The Journal of biological chemistry, 290(44), 26383-26392 (2015-09-16)
Diabetes mellitus is associated with a variety of complications, including alterations in the central nervous system (CNS). We have recently shown that diabetes results in a reduction of cholesterol synthesis in the brain due to decreased insulin stimulation of SREBP2-mediated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service