Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EMU183101

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mcm7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGGTGAATAAGGATGTCTTAGATGTTTACATTGAACACCGGCTGATGATGGAGCAGCGAAGCAGAGACCCTGGGGCAGTCCGGAACCCCCAAAACCAGTATCCTTCTGAACTCATGCGAAGATTTGAGTTGTATTTCCGAGGCCCAAGTAGCAGCAAGCCTCGAGTGATCCGGGAAGTACGAGCTGACTCTGTGGGGAAATTGTTAACTGTGCGTGGCATTGTCACTCGTGTGTCTGAAGTCAAGCCCAGGATGGTGGTGGCCACATACACTTGTGATCAGTGTGGGGCAGAGACCTACCAGCCAATCCAGTCTCCCACTTTCATGCCTCTGATCATGTGCCCCAGCCAGGAGTGCCAGACCAATC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EMU183101-50UG:
EMU183101-20UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Sorry, we don't have COAs for this product available online at this time.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service