Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EMU076311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rela

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAACTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTCTCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTTTTGAGTCAGATCAGCTCCTAAGGTGCTGACAGCGACCCTGCTCAGAGCACCAGGTTTCAGGGCACTGAAGCCTTCCCGAAGTGCGTACACATTCTGGGGAGTGTGCTCCAGCTGCCCCCGACTTGTTTGGGTGATCTCTCTGGGGCGGCACGTTTTACTCTTTATCTCGCTTTCGGAGGTGCTTTCGCAGGAGCATTAACCTCCTGGAGACGGAGCTGGGAGGACTCGGTGCATCCCTGTGTTGATAGCTCCTGCTTCGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EMU076311-50UG:
EMU076311-20UG:


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Martyn K White et al.
PloS one, 9(10), e110122-e110122 (2014-10-14)
The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under
Yun Qu et al.
Cell biochemistry and function, 33(5), 320-325 (2015-07-17)
Nuclear factor-kappaB (NF-κB) is an important transcriptional factor and regulates a variety of pathophysiologic process involved in cell survival and death. This study aimed to assess the effects of NF-κB p65 subunit knockdown in suppression of nude mouse lung tumour
W Zhang et al.
European review for medical and pharmacological sciences, 18(9), 1361-1367 (2014-05-29)
S100A4 is a member of the S100 family of calcium-binding proteins, which possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Here, we demonstrate for the first time a major role of
Maroof Alam et al.
Oncotarget, 5(9), 2622-2634 (2014-04-29)
The capacity of breast cancer cells to form mammospheres in non-adherent serum-free culture is used as a functional characteristic of the self-renewing stem-like cell population. The present studies demonstrate that silencing expression of the MUC1-C oncoprotein inhibits growth of luminal
Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service