Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU223451

Sigma-Aldrich

MISSION® esiRNA

targeting human POU5F1 (2)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACACCTGGCTTCGGATTTCGCCTTCTCGCCCCCTCCAGGTGGTGGAGGTGATGGGCCAGGGGGGCCGGAGCCGGGCTGGGTTGATCCTCGGACCTGGCTAAGCTTCCAAGGCCCTCCTGGAGGGCCAGGAATCGGGCCGGGGGTTGGGCCAGGCTCTGAGGTGTGGGGGATTCCCCCATGCCCCCCGCCGTATGAGTTCTGTGGGGGGATGGCGTACTGTGGGCCCCAGGTTGGAGTGGGGCTAGTGCCCCAAGGCGGCTTGGAGACCTCTCAGCCTGAGGGCGAAGCAGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU223451-20UG:
EHU223451-50UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shaoheng Zhang et al.
Cell death & disease, 8(1), e2548-e2548 (2017-01-13)
Poor cell survival and limited functional benefits have restricted mesenchymal stem cell (MSC) efficacy for treating myocardial infarction (MI), suggesting that a better understanding of stem cell biology is needed. The transcription factor HIF-2α is an essential regulator of the
Axel R Göhring et al.
PloS one, 12(4), e0174912-e0174912 (2017-04-21)
Oct4 was reported to be one of the most important pluripotency transcription factors in the biology of stem cells including cancer stem cells, and progressed malignant cells. Here we report the investigation of gene expression control of Oct4 by selected
Pengmu Xie et al.
Experimental and molecular pathology, 108, 9-16 (2019-03-12)
Endometrial cancer (EC) is ranked as the most common gynecologic malignancy of the female genital tract and the fourth most common neoplasia in women. Accumulated evidences reveal that TRAF4 plays a critical role in the progress of various cancers, but
Lei Liu et al.
Biochemical and biophysical research communications, 461(3), 525-532 (2015-04-26)
Our previous study showed that Octamer-binding transcription factor 4 (OCT4) expression was upregulated and significantly associated with histological grade through the analysis of OCT4 expression in 159 ovarian cancer tissue samples, and OCT4 mediated follicle-stimulating hormone (FSH)-induced anti-apoptosis in epithelial
Ting Zhao et al.
Cell stem cell, 23(1), 31-45 (2018-06-26)
Chemical reprogramming provides a powerful platform for exploring the molecular dynamics that lead to pluripotency. Although previous studies have uncovered an intermediate extraembryonic endoderm (XEN)-like state during this process, the molecular underpinnings of pluripotency acquisition remain largely undefined. Here, we

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service