Skip to Content
Merck
All Photos(1)

Key Documents

EHU119651

Sigma-Aldrich

MISSION® esiRNA

targeting human ID2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAGAACAAGAAGGTGAGCAAGATGGAAATCCTGCAGCACGTCATCGACTACATCTTGGACCTGCAGATCGCCCTGGACTCGCATCCCACTATTGTCAGCCTGCATCACCAGAGACCCGGGCAGAACCAGGCGTCCAGGACGCCGCTGACCACCCTCAACACGGATATCAGCATCCTGTCCTTGCAGGCTTCTGAATTCCCTTCTGAGTTAATGTCAAATGACAGCAAAGCACTGTGTGGCTGAATAAGCGGTGTTCATGATTTCTTTTATTCTTTGCACAACAACAACAACAACAAATTCACGGAATCTTTTAAGTGCTGAACTTATTTTTCAACCATTTCACAAGGAGGACAAGTTGAATGGACCTTTTTAAAAAGAAAAAAAAAATGGAAGGAAAACTAAGAATGATCATCTTCCCAGGGTGTTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yin Liu et al.
Breast cancer research and treatment, 175(1), 77-90 (2019-02-07)
Ductal carcinoma in situ (DCIS) is a non-invasive form of breast cancer which could progress to or recur as invasive breast cancer. The underlying molecular mechanism of DCIS progression is yet poorly understood, and appropriate biomarkers to distinguish benign form
Yilin Pan et al.
Molecular immunology, 128, 106-115 (2020-10-31)
The aims of the present study were to investigate the signaling mechanisms for sphingosine-1-phosphate (S1P)-induced airway smooth muscle cells (ASMCs) proliferation and to explore the effect of activation of adenosine monophosphate-activated protein kinase (AMPK) on S1P-induced ASMCs proliferation and its
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service