Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU054581

Sigma-Aldrich

MISSION® esiRNA

targeting human SND1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCATTGTTGTGAAGCTGAACTCAGGCGATTACAAGACGATTCACCTGTCCAGCATCCGACCACCGAGGCTGGAGGGGGAGAACACCCAGGATAAGAACAAGAAACTGCGTCCCCTGTATGACATTCCTTACATGTTTGAGGCCCGGGAATTTCTTCGAAAAAAGCTTATTGGGAAGAAGGTCAATGTGACGGTGGACTACATTAGACCAGCCAGCCCAGCCACAGAGACAGTGCCTGCCTTTTCAGAGCGTACCTGTGCCACTGTCACCATTGGAGGAATAAACATTGCTGAGGCTCTTGTCAGCAAAGGTCTAGCCACAGTGATCAGATACCGGCAGGATGATGACCAGAGATCATCACACTACGATGAACTGCTTGCTGCAGAGGCCAGAGCTATTAAGAATGGCAAAGGATTGCATAGCAAGAAGGAAGTGCCTATCCACCGTGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU054581-50UG:
EHU054581-20UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huining Li et al.
Oncotarget, 8(12), 19723-19737 (2017-02-06)
miR-320a downexpression contributes to tumorigenesis in several human cancers. However, the relevance of miR-320a to prognosis, proliferation and invasion in gliomas remains unclear. In this study, we demonstrated that miR-320a expression was decreased in human glioma tissues and cell lines.
Yongqiang Zhang et al.
Oncology letters, 15(6), 9553-9558 (2018-05-29)
Glioma is one of the malignant tumor types detrimental to human health; therefore, it is important to find novel targets and therapeutics for this tumor. The downregulated expression of Tudor-staphylococcal nuclease (SN) and alkylglycerone phosphate synthase (AGPS) can decrease cancer
Fei Ma et al.
Oncotarget, 6(19), 17404-17416 (2015-05-13)
MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, we investigated the biological role and mechanism of miR-361-5p in colorectal carcinoma (CRC) and gastric cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service