Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU028581

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2R

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTATTCATCGCACTGGTGGTTATGAGGCTTATGATGAGAGTGAGGATGATGCCTCCGATACCAACCCTGATTTCTACATCAATATTTGTCAGCCACTAAATCCCATGCACGGAGTGCCCTGTCCTGCCGGAGCCGCTGTGTGCAAAGTTCCTATTGATGGTCCCCCCATAGATATCGGCCGGGTAGCAGGACCACCAATACTCAATCCAATAGCAAATGAGATTTACTTGAATTTTGAAAGCAGTACTCCTTGCTTAGCGGACAAGCATTTCAACTACACCTCGCTCATCGCGTTTCACTGTAAGAGAGGTGTGAGCATGGGAACGCCTAAGCTGTTAAGGACCAGCGAGTGCGACTTTGTGTTCGAATGGGAGACTCCTGTCGTCTGTCCTGATGAAGTGAGGATGGATGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU028581-50UG:
EHU028581-20UG:


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ming Sun et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2730-2748 (2020-01-08)
The small GTPase Ras-related protein Rab-7a (Rab7a) serves as a key organizer of the endosomal-lysosomal system. However, molecular mechanisms controlling Rab7a activation levels and subcellular translocation are still poorly defined. Here, we demonstrate that type Igamma phosphatidylinositol phosphate 5-kinase i5
Gui Yang et al.
The Journal of allergy and clinical immunology, 133(6), 1702-1708 (2014-04-05)
The functions of regulatory T (Treg) cells are important in immunity, and the regulatory mechanisms of Treg cell activities are not fully understood yet. We sought to investigate the role of insulin-like growth factor (IGF) 2 in the upregulation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service