Skip to Content
Merck
All Photos(1)

Key Documents

EHU017401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGTGGGATGGAACAGGACAGGAGGTGGTAGTGGATACCAGTTTGGAGAGCCCAGCTGGCCTGGCCATTGATTGGGTCACCAACAAACTGTACTGGACAGATGCAGGTACAGACCGGATTGAAGTAGCCAACACAGATGGCAGCATGAGAACAGTACTCATCTGGGAGAACCTTGATCGTCCTCGGGACATCGTGGTGGAACCCATGGGCGGGTACATGTATTGGACTGACTGGGGTGCGAGCCCCAAGATTGAACGAGCTGGCATGGATGCCTCAGGCCGCCAAGTCATTATCTCTTCTAATCTGACCTGGCCTAATGGGTTAGCTATTGATTATGGGTCCCAGCGTCTATACTGGGCTGACGCCGGCATGAAGACAATTGAATTTGCTGGACTGGATGGCAGTAAGAGGAAGGTGCTGATTGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qian Zhang et al.
Theranostics, 10(2), 602-614 (2020-01-07)
The mineral dust-induced gene (mdig) is overexpressed in a number of human cancers, suggesting critical roles of this gene played on the pathogenesis of cancers. Unlike several other JmjC-domain containing proteins that exhibit histone demethylase activity, it remains enigmatic whether
Xiaofen Zhou et al.
Biochemical and biophysical research communications, 503(1), 257-263 (2018-06-11)
Dysregulation of cell proliferation and death is considered the foundation of the malignant biological characteristics of cancer. In this study, we conducted a comprehensive analysis of a massively parallel whole transcriptome resequencing of paired papillary thyroid cancer and normal thyroid
Kai Wu et al.
Scientific reports, 6, 36305-36305 (2016-11-12)
Several epidemiological studies suggested an increased incidence rate of multiple myeloma (MM) among first responders and other individuals who exposed to World Trade Center (WTC) dust. In this report, we provided evidence showing that WTC dust is potent in inducing

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service