Skip to Content
Merck
All Photos(1)

Key Documents

Safety Information

EHU009201

Sigma-Aldrich

MISSION® esiRNA

targeting human GSTP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGACCTCACCCTGTACCAGTCCAATACCATCCTGCGTCACCTGGGCCGCACCCTTGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATACATCTCCCTCATCTACACCAACTATGAGGCGGGCAAGGATGACTATGTGAAGGCACTGCCCGGGCAACTGAAGCCTTTTGAGACCCTGCTGTCCCAGAACCAGGGAGGCAAGACCTTCATTGTGGGAGACCAGATCTCCTTCGCTGACTACAACCTGCTGGACTTGCTGCTGATCCATGAGGTCCTAGCCCCTGGCTGCCTGGATGCGTTCCCCCTGCTCTCAGCATATGTGGGGCGCCTCAGTGCCCGGCCCAAGCTCAAGGCCTTCCTGGCCTCCCCTGAGTACGTGAACCTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU009201-20UG:
EHU009201-50UG:


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ornanong Tusskorn et al.
Naunyn-Schmiedeberg's archives of pharmacology, 391(6), 657-667 (2018-04-19)
Phenethyl isothiocyanate (PEITC) is a potential cancer prevention agent that is found in cruciferous vegetables. Previous studies have shown that the effect of PEITC-induced cell death declines rapidly after administration. The metabolic fate of PEITC is modulated by glutathione S-transferases
Anette Brockmann et al.
ACS chemical biology, 9(7), 1520-1527 (2014-05-09)
Thiazolides are a novel class of anti-infectious agents against intestinal intracellular and extracellular protozoan parasites, bacteria, and viruses. While the parent compound nitazoxanide (NTZ; 2-(acetolyloxy)-N-(5-nitro-2-thiazolyl)benzamide) has potent antimicrobial activity, the bromo-thiazolide RM4819 (N-(5-bromothiazol-2-yl)-2-hydroxy-3-methylbenzamide) shows only reduced activity. Interestingly, both molecules

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service