Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU210991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hras1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATTGGCAGCCGCTGTAGAAGCTATGACAGAATACAAGCTTGTGGTGGTGGGCGCTGGAGGCGTGGGAAAGAGTGCCCTGACCATCCAGCTGATCCAGAACCACTTTGTGGACGAGTATGATCCCACTATAGAGGACTCCTACCGGAAACAGGTGGTCATTGATGGGGAGACATGTCTACTGGACATCTTAGACACAGCAGGTCAAGAAGAGTATAGTGCCATGCGGGACCAGTACATGCGCACAGGGGAGGGCTTCCTCTGTGTATTTGCCATCAACAACACCAAGTCCTTCGAGGACATCCATCAGTACA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Fanjie Meng et al.
Oncology reports, 32(5), 2023-2030 (2014-09-06)
Ras mutations contribute to human cancer development. The present study assessed the Ras V12 mutation in hepatocellular carcinoma (HCC) cells and the role of its silencing in vitro and in nude mouse xenografts. HCC BEL7402 cells expressed mutations of V12 (Val/Gly)
Francesco Baschieri et al.
Nature communications, 5, 4839-4839 (2014-09-12)
The small GTPase Cdc42 is a key regulator of polarity, but little is known in mammals about its spatial regulation and the relevance of spatial Cdc42 pools for polarity. Here we report the identification of a GM130-RasGRF complex as a
J Hun Hah et al.
Head & neck, 36(11), 1547-1554 (2013-10-15)
The purpose of this study was to identify mechanisms of innate resistance to an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, erlotinib, in a panel of head and neck squamous cell carcinoma (HNSCC) cell lines. Specifically, we analyzed the
Sushmita Chakraborty et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3852-3860 (2015-03-20)
Leishmania major is a parasite that resides and replicates in macrophages. We previously showed that the parasite enhanced CD40-induced Raf-MEK-ERK signaling but inhibited PI3K-MKK-p38MAPK signaling to proleishmanial effects. As Raf and PI3K have a Ras-binding domain but exert opposite effects

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.