Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU208521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emr1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGTGTGATGACACATGTCCTTTGAATTCATCATGTACCAACACTATTGGGAGCTACTTCTGCACTTGCCACCCTGGCTTTGCATCTAGCAATGGACAGCTGAATTTCAAAGACCTAGAGGTGACATGTGAAGATATTGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATGGATCCAGAAGGCTCCCAAGGATATGGAAACTTCAACTGCAAAAGGATCCTCTTCAAGTGTAAGGAAGACTTGATACTCCAAAGTGAGCAGATACAGCAATGCCAAGCAGTGCAGGGCAGGGATCTTGGTTATGCTTCCTTCTGTACACTTGTGAATGCTACCTTCACAATCCTTGATAATACCTGTGAGAACAAAAGTGCCCCAGTGTCCTTACAGAGTGCAGCTACAAGTGTCTCCCTCGTGCTGGAGCAAGCGACCACATGGTTTGAGCTCAGCA

N° accesso Ensembl | topo

ENSMUSG00000004730

N° accesso NCBI

NM_010130

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... EMR1(13733) , Emr1(13733)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Michael J Hansen et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 64(9), 697-706 (2015-07-08)
Adipose tissue macrophages (ATMs) have been implicated in a number of obesity-related diseases. Because the activated macrophages associated with many types of autoimmune and inflammatory diseases express a folate receptor (FR) that can be exploited for FR-targeted drug delivery, we
Takako Serizawa et al.
Infection and immunity, 84(2), 562-572 (2015-12-09)
Histopathological changes of the gastric mucosa after Helicobacter pylori infection, such as atrophy, metaplasia, and dysplasia, are considered to be precursors of gastric cancer, yet the mechanisms of histological progression are unknown. The aim of this study was to analyze
Fabiana N Soki et al.
Oncotarget, 6(34), 35782-35796 (2015-10-16)
Resident macrophages in bone play important roles in bone remodeling, repair, and hematopoietic stem cell maintenance, yet their role in skeletal metastasis remains under investigated. The purpose of this study was to determine the role of macrophages in prostate cancer
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.