Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU196641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkcc

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCACTCCACCTTTCAGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCAACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCAAGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCACCCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTTGGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTCAAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGGGTTCCTGAC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Ci dispiace, ma al momento non ci sono COA disponibili online per questo prodotto.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sergio Carracedo et al.
BMC developmental biology, 13, 16-16 (2013-05-04)
Protein kinase C epsilon (PKCϵ) belongs to the novel PKC subfamily, which consists of diacylglycerol dependent- and calcium independent-PKCs. Previous studies have shown that PKCϵ is important in different contexts, such as wound healing or cancer. In this study, we
Sergio Carracedo et al.
BMC developmental biology, 13, 2-2 (2013-01-12)
The members of the protein kinase C (PKC) family consist of serine/threonine kinases classified according to their regulatory domain. Those that belong to the novel PKC subfamily, such as PKCδ, are dependent on diacylglycerol but not Calcium when considering their
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of
Imene Jaadane et al.
Journal of cellular and molecular medicine, 19(7), 1646-1655 (2015-03-18)
Light-induced retinal degeneration is characterized by photoreceptor cell death. Many studies showed that photoreceptor demise is caspase-independent. In our laboratory we showed that leucocyte elastase inhibitor/LEI-derived DNase II (LEI/L-DNase II), a caspase-independent apoptotic pathway, is responsible for photoreceptor death. In
W Miklos et al.
Cancer letters, 361(1), 112-120 (2015-03-10)
Although triapine is promising for treatment of advanced leukemia, it failed against solid tumors due to widely unknown reasons. To address this issue, a new triapine-resistant cell line (SW480/tria) was generated by drug selection and investigated in this study. Notably

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.