Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU180081

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mif

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCGCTTTGTACCGTCCTCCGGTCCACGCTCGCAGTCTCTCCGCCACCATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTGTCGGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCTCATGACTTTTAGCGGCACGAACGATCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGTGCCCAGAACCGCAACTACAGTAAGCTGCTGTGTGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACCGGGTCTACATCAACTATTACGACATGAACGCTGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGAGTCCTGGCCCCACTTACCTGCACCGCTGTTCTTTGAGCCTCGCTCCACGTAGTGTTCTGTGTTTATCCACCGGTAGCGATGCCCACCTTC

N° accesso Ensembl | topo

ENSMUSG00000033307

N° accesso NCBI

NM_010798

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MIF(17319) , Mif(17319)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ZRU
PRU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels
Y Liu et al.
Cell death & disease, 5, e1361-e1361 (2014-08-08)
Osteosarcoma is a common primary bone tumor in children and adolescents. The drug resistance of osteosarcoma leads to high lethality. Macrophage migration inhibitory factor (MIF) is an inflammation-related cytokine implicated in the chemoresistance of breast cancer. In this study, we
Eun Ju Jeong et al.
Nanoscale, 7(47), 20095-20104 (2015-11-17)
Although chitosan and its derivatives have been frequently utilized as delivery vehicles for small interfering RNA (siRNA), it is challenging to improve the gene silencing efficiency of chitosan-based nanoparticles. In this study, we hypothesized that controlling the spacer arm length
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
Bruno Costa-Silva et al.
Nature cell biology, 17(6), 816-826 (2015-05-20)
Pancreatic ductal adenocarcinomas (PDACs) are highly metastatic with poor prognosis, mainly due to delayed detection. We hypothesized that intercellular communication is critical for metastatic progression. Here, we show that PDAC-derived exosomes induce liver pre-metastatic niche formation in naive mice and consequently
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.