Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU170301

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nol3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGAGGACCTGAGAGGAAACTTGAGTAGACAGAAGCCACACACATCATTGTAACTGCTGTTTAATTGTCTGGCTTTCCTCTGAACTGGGAGCTCAGTGAGGGGCGTGGGGTCTAACCAGTCACAGACATACACAAGGAGCTCTGCACATATCTACTAAGTAAATGAATACAAACTTCCCAGCTGTGTTTCCAAGCTTCACAGATGGAAACATTAACTGAAAAGCCAGGGTTAGGACAGTACTAGCTCACTCTCCCACCGCTGAATCTGAAGTGAAATGAAAGCCTTAACCAGCTCTGTACTAATCCTGGCCTGAACGTGGGATAACAAACCCTAGGGCCTGCCCTGTAGGTTTGATTGTGGTTGCTCCCGCCTGTCCTAACCACTGCCAGAGACCAGCTGTGAGGCTGTGGTTAAAGACAGGCACAACCAAGACTAACATGGGGACTGAGGGTGGGACCAGGTGCTGGACTCACAAGACACAAGACACAGTGTGTCTGTGTGAGTGATAAGAAAGGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

David Kozono et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), E4055-E4064 (2015-07-15)
The available evidence suggests that the lethality of glioblastoma is driven by small subpopulations of cells that self-renew and exhibit tumorigenicity. It remains unclear whether tumorigenicity exists as a static property of a few cells or as a dynamically acquired
Fengfei Wang et al.
Oncotarget, 6(5), 2709-2724 (2015-01-13)
Over-expression of PDGF receptors (PDGFRs) has been previously implicated in high-risk medulloblastoma (MB) pathogenesis. However, the exact biological functions of PDGFRα and PDGFRβ signaling in MB biology remain poorly understood. Here, we report the subgroup specific expression of PDGFRα and
Andrea Ullius et al.
Nucleic acids research, 42(11), 6901-6920 (2014-05-02)
The appropriate expression of the roughly 30,000 human genes requires multiple layers of control. The oncoprotein MYC, a transcriptional regulator, contributes to many of the identified control mechanisms, including the regulation of chromatin, RNA polymerases, and RNA processing. Moreover, MYC

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.