Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU090571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dnmt1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAACCCCAGATGTTGACCAGTGAGAAACTGTCCATCTACGACTCCACCTCGACCTGGTTTGATACTTATGAAGATTCTCCCATGCATAGGTTCACTTCCTTCAGTGTGTACTGCAGTCGCGGGCACCTGTGTCCTGTCGACACCGGTCTCATTGAGAAGAATGTAGAGCTCTACTTTTCTGGGTGTGCCAAAGCAATTCATGACGAGAATCCATCTATGGAAGGTGGTATTAATGGCAAAAACCTCGGGCCAATCAATCAGTGGTGGCTCAGTGGCTTTGATGGTGGCGAGAAGGTGCTCATTGGCTTCTCCACTGCATTTGCTGAATACATTTTGATGGAGCCCAGCAAAGAGTATGAGCCAATATTTGGGCTGATGCAGGAGAAAATTTACATCAGCAAGATTGTTGTTGAGTTCCTGCAAAACAATCCTGATGCTGTATATGAAGACCTGATCAATAAGATTGAGACCACTGTTCCTCCTTCTACCATTAATGTGAACCGGTTCACAGAGGACTCCCTCTTACGCCACGCCCAGTTTGTAGTGAGCCAGGTAGAGAGTTACGACGAAGCCAAGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sichen Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(22), 5808-5822 (2014-09-17)
IDH1/2-mutant gliomas harbor a distinct glioma-CpG island methylation phenotype (G-CIMP) that may promote the initiation and progression of secondary pathway gliomas by silencing tumor-suppressive genes. The potential role of tumor-suppressive microRNAs (miRNA; miR) in this process is not understood. To
A K Mitra et al.
Oncogene, 34(48), 5923-5932 (2015-03-24)
The cross-talk between ovarian cancer (OvCa) cells and the metastatic microenvironment is an essential determinant of successful colonization. MicroRNAs (miRNAs) have several critical roles during metastasis; however, the role of microenvironmental cues in the regulation of miRNAs in metastasizing cancer
Kanwalat Chalertpet et al.
Cancer science, 106(10), 1333-1340 (2015-08-08)
Human papillomavirus (HPV) oncoproteins drive distinctive promoter methylation patterns in cancer. However, the underlying mechanism remains to be elucidated. Cyclin A1 (CCNA1) promoter methylation is strongly associated with HPV-associated cancer. CCNA1 methylation is found in HPV-associated cervical cancers, as well
Hui Zhang et al.
Theriogenology, 84(6), 846-852 (2015-07-22)
RNA interference is an important tool to study the gene function. Microinjection and electroporation are usually used to transfer DNA, small interference RNA (siRNA), morpholinos, and protein into oocytes or embryos. This study used a simple and effective method to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.