Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU084311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cacna1c

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGTTCTCATCCTGCTCAACACCATCTGCCTGGCCATGCAGCACTATGGCCAGAGCTGCCTCTTCAAAATCGCCATGAATATACTCAACATGCTTTTCACCGGCCTCTTCACAGTGGAGATGATCCTGAAGCTCATTGCCTTCAAACCCAAGGGTTACTTTAGTGATCCCTGGAATGTTTTTGACTTCCTCATCGTCATTGGGAGCATAATTGATGTCATTCTCAGTGAGACTAATCCAGCTGAACATACCCAATGCTCTCCCTCTATGAGTGCAGAGGAGAACTCCCGCATCTCCATCACCTTCTTCCGCCTCTTCCGGGTCATGCGCCTGGTGAAGCTGCTGAGCCGCGGGGAAGGCATCCGAACCCTGCTGTGGACCTTCATCAAGTCCTTCCAGGCTCTGCCCTATGTGGCTCTTTTGATTGTGATGCTGTTCTTTATCTATGCAGTGATTGGGATGCAGGTGTTTGGGAAGATTGCCCTGAATGACACC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
F Wang et al.
Acta physiologica (Oxford, England), 214(2), 261-274 (2015-04-08)
The primary aim of this study was to identify the effects of hyperammonaemia on functional expression of Cav1.2 L-type Ca(2+) channels in astroglia. Primary cultures of mouse astrocytes were used to study effects of chronic treatment (1-5 days) with ammonium
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.