Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU082041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCAATGGCAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTCTGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAATGCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTACAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTATACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCCGTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCCCTGAGAACAGGGTGGACGTCAT

N° accesso Ensembl | topo

ENSMUSG00000024304

N° accesso NCBI

NM_007664

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CDH2(12558) , Cdh2(12558)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yu-Huan Tsai et al.
PLoS pathogens, 9(5), e1003381-e1003381 (2013-06-06)
Listeria monocytogenes (Lm) is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the
M-R Lee et al.
Cell death & disease, 5, e1113-e1113 (2014-03-15)
Endoplasmic reticulum (ER) stress is considered one of the pathological mechanisms of idiopathic pulmonary fibrosis (IPF). Therefore, we examined whether an ER stress regulator, Bax inhibitor-1 (BI-1), regulates collagen accumulation, which is both a marker of fibrosis and a pathological
Maorong Jiang et al.
Neurochemical research, 39(11), 2047-2057 (2014-08-15)
Chitosan-based tissue engineered nerve grafts are successfully used for bridging peripheral nerve gaps. The biodegradation products of chitosan are water-dissolvable chitooligosaccharides (COSs), which have been shown to support peripheral nerve regeneration. In this study, we aimed to examine in vitro
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Xuebing Yan et al.
Molecular medicine reports, 12(2), 2999-3006 (2015-05-06)
Recent studies have indicated that the epithelial-mesenchymal transition (EMT) is a key molecular mechanism involved in the development of colorectal cancer (CRC). N-cadherin is a mesenchymal marker of the EMT and has been closely linked to several human malignancies. However

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.