Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU074201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vdac1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AATGACGGGACAGAGTTTGGTGGCTCCATTTACCAGAAGGTGAACAAGAAGTTGGAGACTGCTGTCAATCTCGCCTGGACTGCAGGAAACAGTAACACTCGCTTCGGAATAGCAGCCAAGTATCAGGTCGACCCTGATGCCTGCTTTTCGGCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGCCCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTGTACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGGATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Meghraj Singh Baghel et al.
Molecular neurobiology, 56(3), 1707-1718 (2018-06-20)
Our previous report on hippocampal proteome analysis suggested the involvement of voltage-dependent anion channel (Vdac) 1 in scopolamine-induced amnesia. Further silencing of Vdac1 in young mice reduced the recognition memory. Vdac1 is a porin protein present abundantly on outer mitochondrial
A Mitra et al.
Cell death & disease, 4, e582-e582 (2013-04-06)
Cardiac hypertrophy and myocardial infarction (MI) are two major causes of heart failure with different etiologies. However, the molecular mechanisms associated with these two diseases are not yet fully understood. So, this study was designed to decipher the process of
Sergio Gonzalez et al.
The Journal of clinical investigation, 126(3), 1023-1038 (2016-02-16)
Schwann cells produce myelin sheath around peripheral nerve axons. Myelination is critical for rapid propagation of action potentials, as illustrated by the large number of acquired and hereditary peripheral neuropathies, such as diabetic neuropathy or Charcot-Marie-Tooth diseases, that are commonly

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.