Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EMU068571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tpx2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGAGCGAATCAAGCAACATCCCAAGAACCAGGAAGAGTATAAGGAAGTGAACTTCATGTCTGAACTTCGGAAGCATTCTTCCACGCCTGCCCGAGGAACCAGAGGATGCACTATCATTAAGCCTTTCAACCTGTCCAAAGGGAAGAAAAGAACATTTGATGAAGCAGCTTCTACGTATGTGCCCATTGCACAGCAGGTTGAAGCCTTCCACAAACGAACCCCCAATAGATACCATCTGAGGAACAAGAAGGACGAGAGCTTGTTACCCTCCAAATCTGTGAACAAGATTGCACGAGACCCCCAGACCCCCATACTGCAGACCAAATATCGTACAAGGGCTGTGACTTGCAAAAGTACTGCAGAGCAGGAGGCCGAGGAGCTTGAGAAACTGCAACAATACAAATTCAAAGCACGGGAACTTG

N° accesso Ensembl | topo

ENSMUSG00000027469

N° accesso NCBI

NP_001135450

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... TPX2(72119) , Tpx2(72119)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Tomohiro Miwa et al.
Cancer medicine, 4(7), 1091-1100 (2015-04-29)
The targeting protein for Xklp2 (TPX2) is a microtubule- and, cell cycle-associated protein who's overexpression has been reported in various malignancies. In this study, we verified the overexpression of TPX2 in both surgically resected specimens of pancreatic cancer and multiple
Qingquan Liu et al.
Hepatology research : the official journal of the Japan Society of Hepatology, 45(8), 906-918 (2014-09-30)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2) is a microtubule-associated protein that impacts spindle assembly in human cells. Several studies have shown that the overexpression of TPX2 is correlated with multiple tumor types. However, the role of TPX2 in
Yong Yang et al.
Asian Pacific journal of tropical medicine, 8(12), 1064-1070 (2015-12-27)
To investigate the expression of targeting protein for Xenopus kinesin-like protein 2 (TPX2) in breast cancer tissue and to explore its role in proliferation, migration and invasion of breast cancer cells. The mRNA and protein expressions of TPX2 in breast
Helen Chen et al.
Cell cycle (Georgetown, Tex.), 13(14), 2248-2261 (2014-05-31)
Construction of a mitotic spindle requires biochemical pathways to assemble spindle microtubules and structural proteins to organize these microtubules into a bipolar array. Through a complex with dynein, the receptor for hyaluronan-mediated motility (RHAMM) cross-links mitotic microtubules to provide structural
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.