Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU061611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdpn

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGGCTTGCCAGTAGTCACCCTGGTTGGAATCATAGTTGGCGTCTTGTTAGCCATTGGCTTCGTCGGAGGGATCTTCATTGTTGTTATGAAGAAGATTTCTGGAAGGTCTCGCCCTAAAGAGCTAAACAGAACAGGTTGTTCTCCCAACACATCTGAAAATAAGAGAGCTTCCAACTTGCCCTGTTCCCCATCCTCTTCCTGTGGAGGAAGATGACCCATGGCGTGCCCACCCACCCCACCCACAGCCATGGTGACCCCTCCGCTTGGCCAGCAGTACCAAAGGAAAGATACAGGACAAGCCACAGCCCCTCAAAGCATCTGCCTTTGGAAAACTAAATTTTTAACATAAATGTTATGATCGATGATTCAAAAGACAACATGCTTAGAAAATGGAGCAAAGCCAA

N° accesso Ensembl | topo

ENSMUSG00000028583

N° accesso NCBI

NM_010329

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... PDPN(14726) , Pdpn(14726)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Frédéric Larrieu-Lahargue et al.
PloS one, 7(6), e39540-e39540 (2012-07-05)
Fibroblast Growth Factor receptor (FGFR) activity plays crucial roles in tumor growth and patient survival. However, FGF (Fibroblast Growth Factor) signaling as a target for cancer therapy has been under-investigated compared to other receptor tyrosine kinases. Here, we studied the
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yoshihiko Sawa et al.
PloS one, 9(5), e97165-e97165 (2014-05-20)
The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS)
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.