Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU060181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rnmt

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGAGAAGCAGCAGTGAGCACGTTGCTTTAGAGCAGCACTCCATCCTCCCAGGTGGAGCAGACCATCTCAGAAACATTTGACAGCTGTTTGTTTATTTTAATAGTAAGTTCTCAATGTGTAGGATGCTGCCACAAACTTCAGTGTATGAATTTGACACTTACTGTCTGTGACAGGTTAGCATAATGTGTGTACATAGGGATGAGTTGTCTTGAAGATCTATTTTTAAGTACTGTTGTAATTGTTCCCCTCTACTGTCAAAACTCTAGCAAGGCATGTCAGAGCAGCTGACCTCCCCAGTGCTGTGATGTGTGAGCAGCTGACCTCCCCAGTGCTGGGATGTGTGAATGTGTTTACAGAGCTGATTTGACAGTCGCTAGAATTGGCAGAGGAACGTTCAC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Young-Won Kim et al.
PloS one, 10(7), e0134552-e0134552 (2015-08-01)
Previous studies have shown that c-MET is overexpressed in cases of aggressive bladder cancer (BCa). Identification of crosstalk between c-MET and other RTKs such as AXL and PDGFR suggest that c-MET network genes (c-MET-AXL-PDGFR) may be clinically relevant to BCa.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.