Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU057611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Notch1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAACCCATGTCAGAATGATGCCACTTGCCTGGACCAGATTGGGGAGTTCCAATGCATATGTATGCCAGGTTATGAAGGTGTATACTGTGAAATCAACACGGATGAGTGCGCCAGCAGCCCCTGTCTGCACAATGGCCACTGCATGGACAAGATCAATGAGTTCCAATGTCAGTGCCCCAAAGGCTTCAACGGGCACCTGTGCCAGTATGATGTGGATGAGTGTGCCAGCACACCATGCAAGAACGGTGCCAAGTGCCTGGATGGGCCCAACACCTATACCTGCGTGTGTACAGAAGGTTACACAGGGACCCACTGCGAAGTGGACATTGACGAGTGTGACCCTGACCCCTGCCACTATGGTTCCTGTAAGGATGGTGTGGCCACCTTTACCTGCCTGTGCCAGCCAGGCTACACAGGCCATCACTGTGAGACCAACATCAATGAGTGCCACAGCCAACCGTGCCGCCATGGGGGCACCTGCCAGGACCGTGACAACTCCTACCTCTGCTTATGCCTCAAGG

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Debarshi Banerjee et al.
Cancer research, 75(8), 1592-1602 (2015-03-07)
The Notch pathway plays multiple key roles in tumorigenesis, and its signaling components have therefore aroused great interest as targets for emerging therapies. Here, we show that inhibition of Notch, using a soluble receptor Notch1 decoy, unexpectedly caused a remarkable
Yinan Liu et al.
PloS one, 9(10), e109588-e109588 (2014-10-15)
The Notch signaling pathway plays versatile roles during heart development. However, there is contradictory evidence that Notch pathway either facilitates or impairs cardiomyogenesis in vitro. In this study, we developed iPSCs by reprogramming of murine fibroblasts with GFP expression governed
Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
Yao Cheng et al.
Anti-cancer drugs, 25(7), 778-789 (2014-03-19)
Tumor invasion and migration obstructs the treatment and prognosis of cancer. In this research, we investigated the effect of oroxylin A, a natural compound extracted from Scutellaria radix, the root of Scutellaria baicalensis, on inhibition of the invasion and migration

Global Trade Item Number

SKUGTIN
EMU057611-20UG4061831338447
EMU057611-50UG4061831369762

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.