Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU051511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TAAAGTGCTGCAGTGGCATCCTCAAGGAGATGTTTGCCAAGAAACATGCTGCCTATGCCTGGCCTTTCTACAAGCCTGTGGATGTGGAGGCACTGGGTCTGCACGACTACTGTGACATCATCAAACATCCCATGGACATGAGCACAATCAAGTCTAAACTAGAGTCCCGAGAGTACAGAGATGCCCAGGAATTTGGTGCTGATGTCCGATTGATGTTCTCCAACTGCTACAAGTACAACCCCCCTGACCATGAAGTGGTAGCCATGGCTCGAAAACTCCAGGATGTGTTTGAAATGCGCTTTGCCAAGATGCCTGATGAGCCTGAAGAGCCAGTTGTTACAGTGTCCTCTCCTGCAGTGCCACCCCCTACAAAGGTGGTAGCCCCACCCTCATCTAGTGACAGCAGCAGCGACAGTTCTTCCGACAGCGACAGTTCCACTGA

N° accesso Ensembl | topo

ENSMUSG00000024002

N° accesso NCBI

NM_198094

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... BRD4(57261) , Brd4(57261)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Vaibhav Sahai et al.
Molecular cancer therapeutics, 13(7), 1907-1917 (2014-05-09)
Pancreatic ductal adenocarcinoma (PDAC) is associated with pronounced fibrosis that contributes to chemoresistance, in part, through increased histone acetylation. Because bromodomain (BRD) and extra terminal domain (BET) proteins are "readers" of histone acetylation marks, we targeted BET proteins in PDAC
Deepanwita Sengupta et al.
Epigenetics, 10(6), 460-466 (2015-05-06)
Pathologic c-Myc expression is frequently detected in human cancers, including Merkel cell carcinoma (MCC), an aggressive skin cancer with no cure for metastatic disease. Bromodomain protein 4 (BRD4) regulates gene transcription by binding to acetylated histone H3 lysine 27 (H3K27Ac)
W Liu et al.
Cell death and differentiation, 21(12), 1950-1960 (2014-08-26)
Bromodomain-containing protein 4 (BRD4) is an important epigenetic reader implicated in the pathogenesis of a number of different cancers and other diseases. Brd4-null mouse embryos die shortly after implantation and are compromised in their ability to maintain the inner cell

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.