Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU050011

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Snai1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AAACCCACTCGGATGTGAAGAGATACCAGTGCCAGGCCTGTGCCCGAACCTTCTCCCGCATGTCCTTGCTCCACAAGCACCAAGAGTCTGGCTGCTCCGGAGGCCCTCGCTGACCCTGCTACCTCCCCATCCTCGCTGGCATCTTCCCGGAGCTCACCCTCCTCCTCACTGCCAGGACTCCTTCCAGCCTTGGTCCGGGGACCTGTGGCGTCCATGTCTGGACCTGGTTCCTGCTTGGCTCTCTTGGTGGCCTTTGCCGCAGGTGGCTGATGGAGTGCCTTTGTACCCGCCCAGAGCCTCCTACCCCTCAGTATTCATGAGGTGTAGCCTCTGGACACAGCTGCTTCGAGCCATAGAACTAAAGCCAACCCACTGGCTGGGAAGCTTGAACCCCGCTCAGGGGACCCCACTTCCCTACCTCCCTCAAGG

N° accesso Ensembl | topo

ENSMUSG00000042821

N° accesso NCBI

NM_011427

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... SNAI1(20613) , Snai1(20613)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Qingsheng Dong et al.
PloS one, 9(6), e98651-e98651 (2014-06-25)
Glioblastoma is an extraordinarily aggressive disease that requires more effective therapeutic options. Snail family zinc finger 1, dysregulated in many neoplasms, has been reported to be involved in gliomas. However, the biological mechanisms underlying SNAI1 function in gliomas need further
Wai-Kin So et al.
FEBS letters, 588(21), 3998-4007 (2014-09-28)
Aberrant epidermal growth factor receptor (EGFR) activation is associated with ovarian cancer progression. In this study, we report that the EGFR ligand amphiregulin (AREG) stimulates cell invasion and down-regulates E-cadherin expression in two human ovarian cancer cell lines, SKOV3 and
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Prathap Kumar S Mahalingaiah et al.
Journal of cellular physiology, 230(8), 1916-1928 (2014-12-30)
Oxidative injury to cellular macromolecules has been suggested as a common pathway shared by multiple etiological factors for kidney cancer. Whether the chronic oxidative stress alone is sufficient to induce malignant transformation in human kidney cells is not clear. Therefore

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.