Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU044441

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ppargc1a

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AACAAGCACTTCGGTCATCCCTGTCAAGCTGTGTTTGACGACAAATCAGACAAGACCAGTGAACTAAGGGATGGCGACTTCAGTAATGAACAATTCTCCAAACTACCTGTGTTTATAAATTCAGGACTAGCCATGGATGGCCTATTTGATGACAGTGAAGATGAAAGTGATAAACTGAGCTACCCTTGGGATGGCACGCAGCCCTATTCATTGTTCGATGTGTCGCCTTCTTGCTCTTCCTTTAACTCTCCGTGTCGAGACTCAGTGTCACCACCGAAATCCTTATTTTCTCAAAGACCCCAAAGGATGCGCTCTCGTTCAAGATCCTTTTCTCGACACAGGTCGTGTTCCCGATCACCATATTCCAGGTCAAGATCAAGGTCCCCAGGCAGTAGATCCTCTTCAAGATCCTGTTACTACTATGAATCAAGCCACTACAGACACCGCACACACCGCAATTCTCCCTTGTATGTGAGATCACGTTCAAGGTCACCCTACAGCCGTAGGCCCAGGTACGACAGCTATGAAGCCTATGAGCACGAAAGGCTCAAGAGGGATGAATACCGC

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Azioni biochim/fisiol

Ppargc1a (peroxisome proliferator-activated receptor γ coactivator 1-α) is a transcriptional co-activator. It is down-regulated in prostate cancer and is linked with disease progression. It plays an important role in mitochondrial function and biogenesis. Changes in the methylation pattern of the gene promoter causes changes in the mitochondrial DNA content. It controls endothelial homeostasis by participating in endothelial nitric oxide (NO) synthase (eNOS) activity and NO production. It plays an important role in insulin signaling. It is responsible for the activation of gluconeogenesis in hepatocytes, regulating thermogenesis in brown adipose tissue, fatty acid oxidation in the heart. It also controls reactive oxygen species production.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Epigenetic regulation of an adverse metabolic phenotype in polycystic ovary syndrome: the impact of the leukocyte methylation of PPARGC1A promoter.
Zhao H
Fertility and Sterility, 107, 467-467 (2017)
PGC-1a ameliorates AngiotensinII-induced eNOS dysfunction in human aortic endothelial cells.
Li J
Vascular Pharmacology, 83, 90-90 (2016)
Lack of direct evidence for natural selection at the candidate thrifty gene locus, PPARGC1A.
Cadzow M
BMC Medical Genetics, 17, 80-80 (2016)
Suppression of endothelial PGC-1a is associated with hypoxia-induced endothelial dysfunction and provides a new therapeutic target in pulmonary arterial hypertension.
Ye JX
American Journal of Physiology. Lung Cellular and Molecular Physiology, 310, L1233-L1233 (2016)
The metabolic co-regulator PGC1a suppresses prostate cancer metastasis.
Torrano V, et. al.
Nature Cell Biology, 18, 645-645 (2016)

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.