Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EMU043861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGAGAAGGCTGTGTTCTTCGCAGGGAATGAGTACTGGGTCTATTCTGCTAGTACTCTGGAGCGAGGATACCCCAAGCCACTGACCAGCCTGGGGTTGCCCCCTGATGTCCAGCAAGTAGATGCTGCCTTTAACTGGAGTAAGAACAAGAAGACATACATCTTTGCAGGAGACAAGTTCTGGAGATACAATGAAGTGAAGAAGAAAATGGACCCCGGTTTCCCTAAGCTCATCGCAGACTCCTGGAATGCCATCCCTGATAACCTGGATGCCGTCGTGGACCTGCAGGGTGGTGGTCATAGCTACTTCTTCAAGGGTGCTTATTACCTGAAGCTGGAGAACCAAAGTCTCAAGAGCGTGAAGTTTGGAAGCATCAAATCAGACTGGCTGGGCTGCTGAGCTGGCCCTGTTCCCACGGGCCCTATCATCTTCATCGCTGCACACCAGGTGAAGGATGTGAAGCAGCCTGGCGGCTCTGTCCTCCTCTGTAGTTAACCAGCCTTCTCCTTCACCTGGTGACTTCAGATTTAAGAGGGTGGCTTCTTTTTGTGCCCAAAG

N° accesso Ensembl | topo

ENSMUSG00000031740

N° accesso NCBI

NM_008610

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... MMP2(17390) , Mmp2(17390)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documenti section.

Se ti serve aiuto, non esitare a contattarci Servizio Clienti

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yijing Chu et al.
Experimental cell research, 337(1), 16-27 (2015-07-26)
Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal
Eric A Voll et al.
Oncotarget, 5(9), 2648-2663 (2014-05-07)
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27)
Irina Gradinaru et al.
PloS one, 10(11), e0142787-e0142787 (2015-11-17)
α1a Adrenergic receptors (α1aARs) are the predominant AR subtype in human vascular smooth muscle cells (SMCs). α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular
Suping Yang et al.
Molecular medicine reports, 12(5), 6990-6996 (2015-09-10)
Prostate cancer (PCa) is the second leading cause of cancer‑related mortality among American males. Studies suggest that cigarette smoking is associated with the progression of PCa; however, the molecular mechanisms underlying this process have not been extensively investigated. PCa progression

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.